Sequence download
Sequence format
Sequence download:
No. Subgroup Number of introns Download
1 IA1 80 IA1_seq.fasta.gz | IA1_seq.fasta.zip
2 IA2 15 IA2_seq.fasta.gz | IA2_seq.fasta.zip
3 IA3 56 IA3_seq.fasta.gz | IA3_seq.fasta.zip
4 IB1 42 IB1_seq.fasta.gz | IB1_seq.fasta.zip
5 IB2 18 IB2_seq.fasta.gz | IB2_seq.fasta.zip
6 IB3 7 IB3_seq.fasta.gz | IB3_seq.fasta.zip
7 IB4 89 IB4_seq.fasta.gz | IB4_seq.fasta.zip
8 IC1 837 IC1_seq.fasta.gz | IC1_seq.fasta.zip
9 IC2 32 IC2_seq.fasta.gz | IC2_seq.fasta.zip
10 IC3 328 IC3_seq.fasta.gz | IC3_seq.fasta.zip
11 ID 17 ID_seq.fasta.gz | ID_seq.fasta.zip
12 IE1 38 IE1_seq.fasta.gz | IE1_seq.fasta.zip
13 IE2 58 IE2_seq.fasta.gz | IE2_seq.fasta.zip
14 IE3 111 IE3_seq.fasta.gz | IE3_seq.fasta.zip
15 IE 61 IE_seq.fasta.gz | IE_seq.fasta.zip
Sequence format:

The sequences are in Fasta format as below. Intron sequences are in uppercase, upstream and downstream Exon sequences are in lowercase.

	>Aae.mL2449
	aguuacgcuagggauAAAUUUGUUGUCCAUUUGCUUUGAGAAAAGCAAUAUUAAAUAGGG
	UGAAAUGCAAAAACAACUUAGUUAAUAAGUCAAUUUGCAGCGAAGCUUACCUAAGCAGUC
	UUUAAUUUUAAGUUUAUAUUAAAAACUUUUUUAUUUAAGAAUAAAGGUUAGAACGUUCAA
	CGACUAGAAAGUGAGUAUGCUAACAAUAAUCUUUCCACGAGCGCCCCUACGUCUUUUUAA
	UUAACAUUUACCUUUGUCCUAGCGAUUAAAUAAGUCCAAGGCCUUAUUAUUUGUUUACUU
	UAUAUUUUAAAUAUAAAGUAAUAAAAAUUAAAAACCAGAGGGAAAAGGAAGUAAGAUCAA
	AUAAAGGAAAAAAAGUUAUAAUUAUAAAAUCUGAAAGCUAGUCAUUAUUUAGAAGUAAUA
	UUGAUAAUUAUAUUAUUUCAGAUAUGGUUAAGAAAUUACCAUAAUUUAAUUUACAAUGCA
	AAAGACGAUGACAUAGUCUGAACCAUUUAGUAAUAAAUGGAAAUUAAGGAUAAAGAGCCU
	UAAUAUUUAACAUUUUUGaacaggcugaucgcg
	>Ama.m.COB,4
	cugcguuaguugaauUUGUUUAACAAGUUCCGGAGAAUAGUAAUAUUCUCAUGAAAAUCG
	GGUGAAUUGUCAAGGAGACCUCCUACAAUGGAGAUGACUUGCAGCGAAGCUUAUAUCAGU
	GCUUAAUAGAUAUAAGAACGUUCAACGACUAAUCGGUGAGUAGCACUAACAAUAAACCGG
	ACACUAGGUGGUGAGUACAACCAACAAUAAUCCACCCACGAGCGCCCGACAACCAUAAUU
	AUGGUUGAUGACAUAGUCUGAACAGGCAGGUGACUGUCUGAAGAGAAAUUUAAACGAUUU
	CUCGAUAACAUAAUUGuuguuugggguggau
	......
	......
        



All rights Reserved © Copyright 2006-2007.
To contact us, send email to: rna@whu.edu.cn